View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_229 (Length: 212)
Name: NF0846_low_229
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_229 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 42341022 - 42341204
Alignment:
Q |
1 |
atgaacatggatgagtttctaagtagtatttggaatgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42341022 |
atgaacatggatgagtttctaagtagtatttggaatgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctg |
42341121 |
T |
 |
Q |
101 |
cagctcagaaagggattagcaaacaggcaagtcttcctcgccaaaattcgttatcgattcctgctcctctctgcaggaaaact |
183 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42341122 |
cagctcagaaagggattagcaaacaggcaagtcttcctcgccaaaattcgttatcgattcctgctcctctctgcaggaaaact |
42341204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 783 times since January 2019
Visitors: 6035