View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_236 (Length: 201)
Name: NF0846_low_236
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_236 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 24 - 168
Target Start/End: Complemental strand, 14131344 - 14131200
Alignment:
Q |
24 |
ttgtgcttcagtggtgttcgtttgcgtaggagaaggtgtagaagaagccatggtttaggatcgnnnnnnngctctatgataccatgttagaaggtgagaa |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
14131344 |
ttgtgcttcagtggtgttcgtttgcgtaggagaaggtgtagaagaagccatggtttaggatcgaaaaaaacctctatgataccatgttagaaggtgagaa |
14131245 |
T |
 |
Q |
124 |
tcttcattgttgaagcttgatgaggcttgtaacagaaaatagtta |
168 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14131244 |
tcttcattgttgaagcttgatgaggcttgtaacagaaaatagtta |
14131200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 774 times since January 2019
Visitors: 6035