View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_49 (Length: 526)
Name: NF0846_low_49
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 311 - 512
Target Start/End: Original strand, 41398129 - 41398330
Alignment:
| Q |
311 |
ccaaaaaggcaccagcatcctcttcaaataaataactttctttcatcaccttaatctcattgttaaaattaatattaacaatgttgaagatgatccggtc |
410 |
Q |
| |
|
|||||||||||||| ||||||||||| || || |||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||| | || |
|
|
| T |
41398129 |
ccaaaaaggcaccatcatcctcttcatatgtgtagctttctttcatcaccttaatctcattgttataattgatgttaacaatgttgaagatgatctgttc |
41398228 |
T |
|
| Q |
411 |
tcctttcacaaacttgcttgctgcagcgaattccttccatccatctctaatcttcacatgccatggataattttcataccacattaaacacctctcattc |
510 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||| ||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||| ||| |
|
|
| T |
41398229 |
tcctttcaccaacttgcttgttgcagcaaactcctttcatccatctttaatcttcacatgccatggataatcttcataccaaattaaacacctctcgttc |
41398328 |
T |
|
| Q |
511 |
tc |
512 |
Q |
| |
|
|| |
|
|
| T |
41398329 |
tc |
41398330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 39 times since January 2019
Visitors: 6047