View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_63 (Length: 471)
Name: NF0846_low_63
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 228 - 465
Target Start/End: Original strand, 34121075 - 34121312
Alignment:
| Q |
228 |
tttgatgatgatttaaatcaagtgattgtaacgtccccaaagaatatctacacacgtgtgacgatcaactattctatttggataatctttgtgtgcatat |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34121075 |
tttgatgatgatttaaatcaagtgattgtaacgtccccaaagaatatctacacacgtgtgacgatcaactattctatttggataatctttgtgtgcatat |
34121174 |
T |
 |
| Q |
328 |
ttactaatcaaacccaaccatagggattaacttcaagagtataaataagctaggaatattttatggcatatgttagggaccaaaataattggtagtgtag |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34121175 |
ttactaatcaaacccaaccatagggattaacttcaagagtataaataagctaggaatattttatggcatatgttagggaccaaaataattggtagtgtag |
34121274 |
T |
 |
| Q |
428 |
caggtgttgtttatggtgccttcaagttttcatctcac |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34121275 |
caggtgttgtttatggtgccttcaagttttcatgtcac |
34121312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 147 - 216
Target Start/End: Original strand, 34120842 - 34120911
Alignment:
| Q |
147 |
ttaccaatgggaccctttcatattgatgatagcaagaaattcacaacattatgatccatcataaacatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120842 |
ttaccaatgggaccctttcatattgatgatagcaagaaattcacaacattatgatccatcataaacatta |
34120911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University