View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_64 (Length: 467)
Name: NF0846_low_64
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 167 - 443
Target Start/End: Original strand, 43058382 - 43058659
Alignment:
| Q |
167 |
ataaataaaatgttagcatataaaagaagtattagtgaattgttaatggattacttaatatagattgctttgatccatccaaattcaaactcatctaatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43058382 |
ataaataaaatgttagcatataaaagaaattttagtgaattgttaatggattaattaatatagattgctttgatccatccaaatccaaactcatctaatc |
43058481 |
T |
 |
| Q |
267 |
tataattttgcatcactactaagaattttggacactttaggcacacta-nnnnnnnnaacattaaaataaatggtgttttagagttgtttttatagctta |
365 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43058482 |
tatcattttgcatcactactaagaattttggacactttaggcacactatttttttttaacattaaaataaatggtgttttagagttttttttatagctta |
43058581 |
T |
 |
| Q |
366 |
gatttggttttcttgcttttcattttactttccctaagttctagtgcagtaactaattttttagtaagaaaatgtttc |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43058582 |
gatttggttttcttgcttttcattttactttccctaagttctagtgcagtacctaattttttagtaagaaaatgtttc |
43058659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 58
Target Start/End: Original strand, 43058281 - 43058309
Alignment:
| Q |
30 |
ctaggagcggttctcataattctttgtaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43058281 |
ctaggagcggttctcataattctttgtaa |
43058309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University