View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_72 (Length: 435)
Name: NF0846_low_72
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 98 - 425
Target Start/End: Complemental strand, 35208149 - 35207832
Alignment:
| Q |
98 |
ctaagaccattaagcaacattccgtgaacgtcttccgtaaactatgtttacatttatattttctttgtcaactattaattatgtttatattacttattgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35208149 |
ctaagaccattaagcaacattccgtgaacgtcttccgtaaactatgtttacatttatattttctttgtcaactattaattatgtttatattacttattgt |
35208050 |
T |
|
| Q |
198 |
ggtttaatatattggaatatgggatttggatagctgttttggatatcagtttaatcttgtttgaactatatatttaatatagtttgatgcaatatgaatt |
297 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35208049 |
ggtttaatatattgggatatgggatttggata-------------tcagtttaatcttgtttgaactatatatttaatatagtttgatgcaatatgaatt |
35207963 |
T |
|
| Q |
298 |
tgctgccatttattgatttgtctacttaaggcattgtttccaatttaatcaatattgttgtcactct---gtcatgatgtaatgaaaatggaagaaggat |
394 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35207962 |
tgctgccatttattgatttgtctagttaaggcattgtttccaatttaatcaatattgttgtcactctgtcgtcatgatgtaatgaaaatggaagaaggat |
35207863 |
T |
|
| Q |
395 |
cgactcttcttccggcactcactagtctgtg |
425 |
Q |
| |
|
||||||| ||||||||| |||||||||||| |
|
|
| T |
35207862 |
cgactctccttccggcaggcactagtctgtg |
35207832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 254 - 317
Target Start/End: Complemental strand, 35199738 - 35199679
Alignment:
| Q |
254 |
ttgtttgaactatatatttaatatagtttgatgcaatatgaatttgctgccatttattgatttg |
317 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
35199738 |
ttgtttgaactatata----atatactttgatgcaatatgaatttgctgcaaattattgatttg |
35199679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 282 - 317
Target Start/End: Complemental strand, 35147207 - 35147172
Alignment:
| Q |
282 |
tgatgcaatatgaatttgctgccatttattgatttg |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35147207 |
tgatgcaatacgaatttgctgccatttattgatttg |
35147172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 834 times since January 2019
Visitors: 6035