View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_80 (Length: 408)
Name: NF0846_low_80
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_80 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 103 - 408
Target Start/End: Complemental strand, 43098574 - 43098270
Alignment:
| Q |
103 |
cagacatatccccaaatttgttggttacaagacatatccccaattggattcaatgttggaatctcattcttcgannnnnnnatgtttataaatcacttag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43098574 |
cagacatatccccaaatttgttggttacaagacatatccccaattggattcaatgttggaatctcattcttcgatttttttatgtttataaatcacttag |
43098475 |
T |
 |
| Q |
203 |
ttaataatttattttgcaacctttctatatgccttttcatttgctcattatgtatttccacgtgacattgcattgggtagatcgatccacatctcaaaag |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098474 |
ttaataatttattttgcaacctttctatatgctttttcatttgctcattatgtatttccacgtgacattgcattgggtagatcgatccacatctcaaaag |
43098375 |
T |
 |
| Q |
303 |
aataattaagtaaaattgggcaaaacaaagaatcttttacagataaacaattttaatatatttccacacgagatagcaacaaccaacaatgacccaattg |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43098374 |
aataattaagtaaaattgggcaaaacaaagaatcttttacagat-aacaattttaatatatttccacacgagatagcaacaaccaataatgacccaattg |
43098276 |
T |
 |
| Q |
403 |
acaatt |
408 |
Q |
| |
|
|||||| |
|
|
| T |
43098275 |
acaatt |
43098270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University