View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_82 (Length: 401)
Name: NF0846_low_82
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 11 - 364
Target Start/End: Complemental strand, 6354937 - 6354610
Alignment:
| Q |
11 |
cacagaccaaccacaaggaaacaaggtgaaccgccccactgtccacaacaccaaacaatggtcaatcgcaggatacaatctcgtggattccacgaccatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354937 |
cacagaccaaccacaaggaaacaaggtgaaccgccccactgtccacaacaccaaacaatggtcaatcgcaggatacaatctcgtggattccacgaccatt |
6354838 |
T |
|
| Q |
111 |
catagaacatacagggagagacagatggaacctgtacatagtcctagtccactcccacgaccacacttgtatctcctccaccacttcttcaatagactca |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
6354837 |
catagaacatacagggagaggcagatggaacttgtacatag------tccactcccacgaccac--------------------ttcttcaatagactca |
6354764 |
T |
|
| Q |
211 |
acaccatcattgaaaattctgagttaatcaaagtcagactctctctaattgacaattgtctacttttccaacaagtagacaacattttcatcaacgacga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354763 |
acaccatcattgaaaattctgagttaatcaaagtcagactctctctaattgacaattgtctacttttccaacaagtagacaacattttcatcaacgacga |
6354664 |
T |
|
| Q |
311 |
cacaataggcttccaagtatcaactctccttagattggcacccatcaaaatacc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354663 |
cacaataggcttccaagtatcaactctccttagattggcacccatcaaaatacc |
6354610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 149 times since January 2019
Visitors: 6045