View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_86 (Length: 386)
Name: NF0846_low_86
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0846_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 68 - 349
Target Start/End: Complemental strand, 47843511 - 47843234
Alignment:
| Q |
68 |
acatggaatataaacctcccattaattttcagactatattcacatattcttgctatagttatcagtttccaactagtgtgaaatatagagaaattatagg |
167 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
47843511 |
acatggaatataaacctcccattcattttcagacgatattcacatattcttgctatagttatcagcttctaactagtgtgaaatatagagaaattatagg |
47843412 |
T |
|
| Q |
168 |
acaaacaaaccgatagatgattcaaccaaacatcatcgtttatcacgtccagcaaaaaataatatttaagtctatggaccaaccgctaccatttttgact |
267 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47843411 |
acaaacaaaccgatagatgattcaactaaacatcatcgtttatcacgtccagcaaaaaataatattgaagtctatggaccaaccgctaccatttttgact |
47843312 |
T |
|
| Q |
268 |
tgtttgcttataaagtcaaagaaagaggtcacaatcatataaaagctcacatatactcctatcctggctctcactgagtgtg |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47843311 |
tgtttgcttataaagtca----aagaggtcacaatcatataaaagctcacgtatactcctatcctggctctcactgagtgtg |
47843234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1 times since January 2019
Visitors: 6040