View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0846_low_96 (Length: 379)
Name: NF0846_low_96
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0846_low_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 16 - 350
Target Start/End: Complemental strand, 36942980 - 36942646
Alignment:
Q |
16 |
atcacaaacaatctcacagatttcacatctcatttcacatttacaatagattcacagaatagacaaatgtatggagatgggattgcattcttcctagccc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36942980 |
atcacaaacaatctcacagatttcacatctcatttcacatttacaatagattcacagaatagacaaatgtatggagatgggattgcattcttcctagccc |
36942881 |
T |
 |
Q |
116 |
cttatggttcaaaaaagcctaatgcaacaaaaggtggttctatgggtctaacacttgataaccaaaggttgaactcaactgataatccatttgttgctgt |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
36942880 |
cttatggttcaaaaaagcctaatgcaacaaaaggtggttctatgggtctaacacttgataatcaaaggttgaactcaactgataatccatttgttgctgt |
36942781 |
T |
 |
Q |
216 |
ggagtttgatatctatcggaatcattgggatccacctcttgaacatgccggaatcgacatcaactccatgctgtctgttgctaatgttacatggttggct |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
36942780 |
ggagtttgatatctatcggaatcattgggatccacctcttgaacatgccggaatcgacatcaactctatgctgtctgttgctaatgttacatggttggct |
36942681 |
T |
 |
Q |
316 |
gatatcaaacaaggcagactcaatgaggcttggat |
350 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
36942680 |
gatatcaaacaaggtagactcaatgaggcttggat |
36942646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University