View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_18 (Length: 450)
Name: NF0847_high_18
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 157 - 442
Target Start/End: Original strand, 5751012 - 5751297
Alignment:
| Q |
157 |
gtttgcaagatttactttgaggtggtggtgaagggttgattataagggtttgaatttaaaggagagtgatgatgaatgaggaggtttcttgagggtttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5751012 |
gtttgcaagatttactttgaggtggtggtgaagggttgattataagggtttgaatttaaaggagagtgatgatgaatgaggaggtttcttgagggtttct |
5751111 |
T |
 |
| Q |
257 |
ttttggtagatggatgatgagtagccgacacaaaaaggtatcaaatcctttctttgttattaattgattccataaactaagattgcctatatttggctat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5751112 |
ttttggtagatggatgatgagtagccgacacaaaaaggtatcaaatcctttctttgttattaattgattccataaactaagattgcctatatttgtctat |
5751211 |
T |
 |
| Q |
357 |
gaaggtaacgggaatgggtatgtatggcattagccattgattggtagctattataggggagtgatcccactttgcttatattattg |
442 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5751212 |
gaaggtatcgggtatgggtatgtatggcatttgccattgattggtagctattataggggagtggtcccactttgcttatattattg |
5751297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 5750885 - 5750964
Alignment:
| Q |
30 |
gttacaattcttaccattgtttcttcaaaatctccatgatgaaagcctttgaatacgcaattacccattttgcatgaatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750885 |
gttacaattcttaccattgtttcttcaaaatctccatgatgaaagcctttgaatacgcaattacccattttgcatgaatc |
5750964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University