View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_28 (Length: 388)
Name: NF0847_high_28
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 164 - 323
Target Start/End: Complemental strand, 38930309 - 38930149
Alignment:
| Q |
164 |
taattagtatgagacgtaactggatcaatcatccatattttgaggaccaaaaatgatagaggctcaattacccactcac-aatgagtggaaactttattt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38930309 |
taattagtatgagacgtaactggatcaatcatccatattttgaggaccaaaaatgatagaggctcaattacccactcgcaaatgagtggaaactttattt |
38930210 |
T |
|
| Q |
263 |
ctcaatagtacaaacttctcacaaccaaacttttttagcaaccaacttagcttggtacgtt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38930209 |
ctcaatagtacaaacttctcacaaccaaaactttttagcaaccaacttagcttggtacgtt |
38930149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 38932238 - 38932177
Alignment:
| Q |
98 |
tggaatgattgacatctatgaaaatggaaccatattttgatggggccaatatgttaaagaagt |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
38932238 |
tggaatgatagacatctatgaaaatggaaccatattttgacgggg-caatatgttaaagaagt |
38932177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 12088706 - 12088761
Alignment:
| Q |
8 |
ccaataatatcatcataattaacaatagtctcacctcatatattaacaccaccaccac |
65 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12088706 |
ccaacaatatcatcaaaattaacaatagtctcacctc--atattaacaccaccaccac |
12088761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2377 times since January 2019
Visitors: 6162