View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_42 (Length: 252)
Name: NF0847_high_42
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0847_high_42 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 138 - 252
Target Start/End: Original strand, 34817527 - 34817641
Alignment:
Q |
138 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34817527 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact |
34817626 |
T |
 |
Q |
238 |
atggagaagatgaaa |
252 |
Q |
|
|
||||||||||||||| |
|
|
T |
34817627 |
atggagaagatgaaa |
34817641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 35867676 - 35867742
Alignment:
Q |
161 |
taccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttct |
227 |
Q |
|
|
|||||||||||||||||||||||||| | ||| |||||||| ||||| || |||||||||| ||||| |
|
|
T |
35867676 |
taccaaatttgaccgagaggtgcttttctagcaagaagctgatgtgagtaaaacattgtttgtttct |
35867742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University