View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_44 (Length: 251)
Name: NF0847_high_44
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_high_44 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 113 - 251
Target Start/End: Original strand, 24653372 - 24653510
Alignment:
| Q |
113 |
ttcccatgtgattcccctaattgatcaaggatacttctcatccaaacatcttgacaagcacatgaagttgctgctacttctggatagagtgaaaataggc |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24653372 |
ttcccatttgattcccctaattgatcaaggatccttctcatccaaacatcttgacaagcacatgaagtagctgctacttctggatagagtgaaaataggc |
24653471 |
T |
 |
| Q |
213 |
tgcttcttagaagaccaagatattgatccttatcccagc |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24653472 |
tgcttcttagaagaccaagatactgatccttatcccagc |
24653510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 9938675 - 9938726
Alignment:
| Q |
20 |
tatctcacatctatgtgtttgtatcttccacgcatcactggatttttagaca |
71 |
Q |
| |
|
|||||||||||||| |||||| |||| ||| |||||||||| |||||||||| |
|
|
| T |
9938675 |
tatctcacatctatatgtttgcatctcccatgcatcactgggtttttagaca |
9938726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 7748542 - 7748491
Alignment:
| Q |
99 |
gtatcactttgcatttcccatgtgattcccctaattgatcaaggatacttct |
150 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||||||| ||||| ||||| |
|
|
| T |
7748542 |
gtatcactgtgcatttcccttgtgactcccctaattgatcgaggatccttct |
7748491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University