View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_45 (Length: 250)
Name: NF0847_high_45
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 19972214 - 19971962
Alignment:
| Q |
1 |
gtctcagaaaattctttccttggttgagtggaacattaaaatcttatttatgatataccggtcacaaaccttgctgcaaaagaccctataaatatctttt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19972214 |
gtctcagaaaagtctttccttggttgagtggaacattaaaatcttatttatgattgaccggtcacaaaccttgctgcaaaagaccctataaatatctttt |
19972115 |
T |
 |
| Q |
101 |
cactaaggc-----------taaggctctgttctggaggaggggcatacatgcaaaattcgagaaatctttcatatatttggagagagggcttttgcaga |
189 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
19972114 |
cactaaggcaaagagaaggctaaggctctgttctggaggaggggcatacatgcaaaattcgagaaatctttcatatatgttgagagagggcttttgcaga |
19972015 |
T |
 |
| Q |
190 |
gaaaaataaacaaatagttataattaatttatttttaatattaagagtattat |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19972014 |
gaaaaataaacaaataattataattaatttatttttaatattaagagtattat |
19971962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University