View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_high_51 (Length: 224)
Name: NF0847_high_51
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 12088812 - 12088706
Alignment:
| Q |
1 |
atagtaaaagtttgtagtggcataattggtgtagttatatggacgtaaatggtggtggtggtgttaatatatgaggtgagactattgttaattatgatga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
12088812 |
atagtaaaagtttgtagtggcataactggtgtagttatatggacgtaaatggtggtggtggtgtta--atatgaggtgagactattgttaattttgatga |
12088715 |
T |
|
| Q |
101 |
tattgttgg |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
12088714 |
tattgttgg |
12088706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2234 times since January 2019
Visitors: 6160