View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_38 (Length: 370)
Name: NF0847_low_38
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_38 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0032 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 186 - 323
Target Start/End: Complemental strand, 36269 - 36132
Alignment:
| Q |
186 |
catttcttgtgcacggcatatgaatggtagtctaaggtgtcaacacaaatgagaattattttctctataatgattcgtttgtgtttcagttttgcttaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36269 |
catttcttgtgcacggcatatgaatggtagtctaaggtgtcaacacaaatgagaattattttctctataatgattcgtttgtgtttcatttttgcttaaa |
36170 |
T |
|
| Q |
286 |
tacttggaatcaaaagtaatgtgtagaagcaacagcta |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36169 |
tacttggaatcaaaagtaatgtgtagaagcaaccgcta |
36132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 21 - 128
Target Start/End: Original strand, 52926080 - 52926187
Alignment:
| Q |
21 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagatcaccttcaagagcggaaatgcagg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
52926080 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
52926179 |
T |
|
| Q |
121 |
gtggaacg |
128 |
Q |
| |
|
|||||||| |
|
|
| T |
52926180 |
gtggaacg |
52926187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2647 times since January 2019
Visitors: 6164