View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_45 (Length: 335)
Name: NF0847_low_45
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 83 - 199
Target Start/End: Complemental strand, 10265967 - 10265850
Alignment:
| Q |
83 |
cgaataatatgagagaaatgacaagggaatccaaatcccagacttgggtagtatgatggagagaatgaaattttgttcatg-ggggtggtttagttgtaa |
181 |
Q |
| |
|
||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
10265967 |
cgaataacatgagagaaatgacaagaggatccaaatcccagacttgggtagtatgatggagagaataaaattttgttcatggggggtggtttagttgtaa |
10265868 |
T |
 |
| Q |
182 |
aaagaaaggaataataac |
199 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10265867 |
aaagaaaggaataataac |
10265850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 83 - 199
Target Start/End: Complemental strand, 10284992 - 10284875
Alignment:
| Q |
83 |
cgaataatatgagagaaatgacaagggaatccaaatcccagacttgggtagtatgatggagagaatgaaattttgttcatg-ggggtggtttagttgtaa |
181 |
Q |
| |
|
||||||| ||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
10284992 |
cgaataacatgagagaaatgataagaggatccaaatcccagacttgggtagtatgatggagagaataaaattttgttcatggggggtggtttagttgtaa |
10284893 |
T |
 |
| Q |
182 |
aaagaaaggaataataac |
199 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10284892 |
aaagaaaggaataataac |
10284875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University