View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_46 (Length: 327)
Name: NF0847_low_46
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0847_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 66 - 243
Target Start/End: Original strand, 44047650 - 44047827
Alignment:
Q |
66 |
atgaattttgatggcaacaagtttgagtctagtgctacttcagcgagaaaattgtcaagtaatttggataccttaagaattgagctttgttttggagatc |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44047650 |
atgaattttgatggcaacaagtttgagtctagtgctacttcagcgagaaaattgtcaagtaatttggataccttaagaattgagctttgttttggagatc |
44047749 |
T |
 |
Q |
166 |
caggactgtcaaattcatactcgtacatcatttgattttcatctctgaagtcactgtcttcatcatccacctcgtcca |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44047750 |
caggactgtcaaattcatactcgtacatcatttgattttcatctctgaagtcactgtcttcatcatccacctcgtcca |
44047827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 39824364 - 39824240
Alignment:
Q |
60 |
agtgagatgaattttgatggcaacaagtttgagtctagtgctacttcagcgagaaaattgtcaagtaatttggataccttaagaattgagctttgttttg |
159 |
Q |
|
|
||||| ||||| |||||||| | |||||||| ||||| ||||||||||| ||| | || || || |||||||||||||||||||||||||||||||||| |
|
|
T |
39824364 |
agtgaaatgaactttgatggaagcaagtttgggtctaaagctacttcagcaagatagttatccagcaatttggataccttaagaattgagctttgttttg |
39824265 |
T |
 |
Q |
160 |
gagatccaggactgtcaaattcata |
184 |
Q |
|
|
| ||||| || || ||||| ||||| |
|
|
T |
39824264 |
gcgatcctgggctatcaaaatcata |
39824240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University