View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_49 (Length: 296)
Name: NF0847_low_49
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 52 - 284
Target Start/End: Complemental strand, 1788596 - 1788364
Alignment:
| Q |
52 |
taaacaatttccaaactaagattacaaaacttgagcttaataacaatcatttcatggaccaattggaatactaagatcttctagagtttctttagtaaaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1788596 |
taaacaatttccaaactaagattacaaaacttgagcttaataacaatcatttcatggaccaattggaatactaagatcttctagagtttctttagtaaaa |
1788497 |
T |
|
| Q |
152 |
ttcttccttccctttgaaatcaataaggcctcttctagtgttttgacaacttgttccatggatggtctttgttggtcaagggatgtgcatgatagagcca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1788496 |
ttcttccttccctttgaaatcaataaggcctcttctagtgttttgacaacttgttccatggatggtctttgttggtcaagggatgtgcatgatagagcca |
1788397 |
T |
|
| Q |
252 |
attgaagtgtaaaatcaaatgcttcttcagaat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1788396 |
attgaagtgtaaaatcaaatgcttcttcagaat |
1788364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2474 times since January 2019
Visitors: 6164