View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_55 (Length: 269)
Name: NF0847_low_55
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 34817456 - 34817247
Alignment:
| Q |
1 |
gcggcaacgatgcacgctaagatcaacaggaagaagttgaataagctcaatatcatcaaaatctggtaactataatcgattattcacattcttcttctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34817456 |
gcggcaacgatgcacgctaagatcaacaggaagaagttgaataagctcaatatcatcaaaatctggtaactataatctattattcacattcttcttctaa |
34817357 |
T |
|
| Q |
101 |
ctttaaccgaaatcgttcttacggtgtcgttttttgcttcttcacagtgaagaaattctgaatccagcgattcccatggctcttagactttctggaatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34817356 |
ctttaaccgaaatcgttcttacggtgtcgttttttgcttcttcacagtgaagaaattctgaatccagcgattcccatggctcttagactttctggaatac |
34817257 |
T |
|
| Q |
201 |
tcatgggtaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
34817256 |
tcatgggtaa |
34817247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 35867380 - 35867308
Alignment:
| Q |
138 |
ttcttcacagtgaagaaattctgaatccagcgattcccatggctcttagactttctggaatactcatgggtaa |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35867380 |
ttcttcacagtgaagagattctgaatccagcgattcccatggctctgagactttctggaatactcatgggtaa |
35867308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 35867517 - 35867449
Alignment:
| Q |
1 |
gcggcaacgatgcacgctaagatcaacaggaagaagttgaataagctcaatatcatcaaaatctggtaa |
69 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867517 |
gcggcaacgatgcacgccaagatcaacaggaagaagttgaataagctcaatatcatcaaaatctggtaa |
35867449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2412 times since January 2019
Visitors: 6162