View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0847_low_59 (Length: 251)

Name: NF0847_low_59
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0847_low_59
NF0847_low_59
[»] chr6 (1 HSPs)
chr6 (113-251)||(24653372-24653510)
[»] chr8 (1 HSPs)
chr8 (20-71)||(9938675-9938726)
[»] chr7 (1 HSPs)
chr7 (99-150)||(7748491-7748542)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 113 - 251
Target Start/End: Original strand, 24653372 - 24653510
Alignment:
113 ttcccatgtgattcccctaattgatcaaggatacttctcatccaaacatcttgacaagcacatgaagttgctgctacttctggatagagtgaaaataggc 212  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
24653372 ttcccatttgattcccctaattgatcaaggatccttctcatccaaacatcttgacaagcacatgaagtagctgctacttctggatagagtgaaaataggc 24653471  T
213 tgcttcttagaagaccaagatattgatccttatcccagc 251  Q
    |||||||||||||||||||||| ||||||||||||||||    
24653472 tgcttcttagaagaccaagatactgatccttatcccagc 24653510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 9938675 - 9938726
Alignment:
20 tatctcacatctatgtgtttgtatcttccacgcatcactggatttttagaca 71  Q
    |||||||||||||| |||||| |||| ||| |||||||||| ||||||||||    
9938675 tatctcacatctatatgtttgcatctcccatgcatcactgggtttttagaca 9938726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 7748542 - 7748491
Alignment:
99 gtatcactttgcatttcccatgtgattcccctaattgatcaaggatacttct 150  Q
    |||||||| |||||||||| ||||| |||||||||||||| ||||| |||||    
7748542 gtatcactgtgcatttcccttgtgactcccctaattgatcgaggatccttct 7748491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 719 times since January 2019
Visitors: 6130