View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0847_low_60 (Length: 250)

Name: NF0847_low_60
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0847_low_60
NF0847_low_60
[»] chr5 (1 HSPs)
chr5 (1-242)||(19971962-19972214)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 19972214 - 19971962
Alignment:
1 gtctcagaaaattctttccttggttgagtggaacattaaaatcttatttatgatataccggtcacaaaccttgctgcaaaagaccctataaatatctttt 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
19972214 gtctcagaaaagtctttccttggttgagtggaacattaaaatcttatttatgattgaccggtcacaaaccttgctgcaaaagaccctataaatatctttt 19972115  T
101 cactaaggc-----------taaggctctgttctggaggaggggcatacatgcaaaattcgagaaatctttcatatatttggagagagggcttttgcaga 189  Q
    |||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
19972114 cactaaggcaaagagaaggctaaggctctgttctggaggaggggcatacatgcaaaattcgagaaatctttcatatatgttgagagagggcttttgcaga 19972015  T
190 gaaaaataaacaaatagttataattaatttatttttaatattaagagtattat 242  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||    
19972014 gaaaaataaacaaataattataattaatttatttttaatattaagagtattat 19971962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1196 times since January 2019
Visitors: 6138