View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_68 (Length: 220)
Name: NF0847_low_68
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_68 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 106 - 220
Target Start/End: Original strand, 34817527 - 34817641
Alignment:
| Q |
106 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34817527 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact |
34817626 |
T |
 |
| Q |
206 |
atggagaagatgaaa |
220 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34817627 |
atggagaagatgaaa |
34817641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 35867676 - 35867742
Alignment:
| Q |
129 |
taccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttct |
195 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||| ||||| || |||||||||| ||||| |
|
|
| T |
35867676 |
taccaaatttgaccgagaggtgcttttctagcaagaagctgatgtgagtaaaacattgtttgtttct |
35867742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University