View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0847_low_68 (Length: 220)

Name: NF0847_low_68
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0847_low_68
NF0847_low_68
[»] chr5 (2 HSPs)
chr5 (106-220)||(34817527-34817641)
chr5 (129-195)||(35867676-35867742)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 106 - 220
Target Start/End: Original strand, 34817527 - 34817641
Alignment:
Q  106 atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34817527 atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttcttctagaaact 34817626  T
Q  206 atggagaagatgaaa 220  Q
    |||||||||||||||    
T  34817627 atggagaagatgaaa 34817641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 35867676 - 35867742
Alignment:
Q  129 taccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgtttatttct 195  Q
    |||||||||||||||||||||||||| | ||| |||||||| ||||| || |||||||||| |||||    
T  35867676 taccaaatttgaccgagaggtgcttttctagcaagaagctgatgtgagtaaaacattgtttgtttct 35867742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 741 times since January 2019
Visitors: 6131