View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_69 (Length: 217)
Name: NF0847_low_69
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 52762168 - 52761988
Alignment:
| Q |
12 |
cagaacctgtgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatgt |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762168 |
cagaacctatgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatgt |
52762069 |
T |
|
| Q |
112 |
atgaatcctttaattaccaatctttgtcctttctcactttgcattcttgatgacgcttcggactacagtttccataatgttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
52762068 |
atgaatcctttaattaccaatctttgtcc-ttctcactttgtattctttatgacgcttcggactacattttccataatgttg |
52761988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1811 times since January 2019
Visitors: 6150