View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_70 (Length: 215)
Name: NF0847_low_70
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 11 - 153
Target Start/End: Original strand, 30970222 - 30970364
Alignment:
| Q |
11 |
gtgagatgaagtgagctgaacaatttgtataaagacccaagaatcacattccacaagaagggaaataataccctgatcacaaaaggttttaagaccatat |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30970222 |
gtgagatgaagtgagttgaacaatttgtataaagacccaagaatcacattccacaagaagggaaataataccctgatcccaaaaggttttaagaccatat |
30970321 |
T |
 |
| Q |
111 |
tcaagagacctcaaagctcaacataaatagcagtggaggtttt |
153 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30970322 |
taaagagacctcaaagctcaacataaatagcggtggaggtttt |
30970364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University