View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0847_low_72 (Length: 214)
Name: NF0847_low_72
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0847_low_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 55 - 134
Target Start/End: Original strand, 49542656 - 49542733
Alignment:
| Q |
55 |
gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgct |
134 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49542656 |
gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgtttttta--ctcaattctctctgct |
49542733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49542559 - 49542615
Alignment:
| Q |
1 |
actggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49542559 |
actggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc |
49542615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1022 times since January 2019
Visitors: 6135