View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0847_low_76 (Length: 201)

Name: NF0847_low_76
Description: NF0847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0847_low_76
NF0847_low_76
[»] chr3 (1 HSPs)
chr3 (1-85)||(12088788-12088869)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 12088788 - 12088869
Alignment:
1 ttatgccactacaaacttttactatatactttaagaagaaacttaacattttgccccgtcattttaattacttctaaccttacct 85  Q
    ||||||||||||||||||||||||||||| ||||||   |||||||||||| ||||| |||||||||||||||||||||||||||    
12088788 ttatgccactacaaacttttactatatacattaaga---aacttaacatttcgccccatcattttaattacttctaaccttacct 12088869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 577 times since January 2019
Visitors: 6130