View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848-Insertion-1 (Length: 957)
Name: NF0848-Insertion-1
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848-Insertion-1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 8e-42
Query Start/End: Original strand, 145 - 261
Target Start/End: Original strand, 34900108 - 34900224
Alignment:
| Q |
145 |
acaatgtgacatattcatttatgacgtgtcgcgcttattatactacactaaaaatccatgttnnnnnnntatatgtttaataagcattgacacaccataa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34900108 |
acaatgtgacatattcatttatgacgtgtcgcgcttattagactccactaaaaatccatgttaaataaatatatgtttaataagcattgacacaccataa |
34900207 |
T |
 |
| Q |
245 |
atgattagacacatcat |
261 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34900208 |
atgattagacacatcat |
34900224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 34899971 - 34900032
Alignment:
| Q |
8 |
gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttcttcaaa |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34899971 |
gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttattcaaa |
34900032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University