View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0848-Insertion-1 (Length: 957)

Name: NF0848-Insertion-1
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0848-Insertion-1
NF0848-Insertion-1
[»] chr3 (2 HSPs)
chr3 (145-261)||(34900108-34900224)
chr3 (8-69)||(34899971-34900032)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 8e-42
Query Start/End: Original strand, 145 - 261
Target Start/End: Original strand, 34900108 - 34900224
Alignment:
145 acaatgtgacatattcatttatgacgtgtcgcgcttattatactacactaaaaatccatgttnnnnnnntatatgtttaataagcattgacacaccataa 244  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||       |||||||||||||||||||||||||||||||    
34900108 acaatgtgacatattcatttatgacgtgtcgcgcttattagactccactaaaaatccatgttaaataaatatatgtttaataagcattgacacaccataa 34900207  T
245 atgattagacacatcat 261  Q
    |||||||||||||||||    
34900208 atgattagacacatcat 34900224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 34899971 - 34900032
Alignment:
8 gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttcttcaaa 69  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34899971 gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttattcaaa 34900032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University