View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848-Insertion-2 (Length: 232)
Name: NF0848-Insertion-2
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0848-Insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 29220536 - 29220756
Alignment:
Q |
8 |
aaaggtttgtcaatatgccacaatccaaccatgtgaaggttaaagaaagatttcccaaacaatactcgcattacgattgaaatggacgccttagaaaaac |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
29220536 |
aaaggtttgtcaatatgccacaatccaaccatgcgaaggttaaagaaagatttcccaaacaatagtcgcattacgattgaaatggacgccttagaaaaac |
29220635 |
T |
 |
Q |
108 |
agtcaagataaatatgaactgtgtcgaatgtccggacatatccgcaaatattatccttagaaaattggctttgctacttagttggaagtagannnnnnna |
207 |
Q |
|
|
||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
29220636 |
agttaagataaatatgaactgtgtcgaatgtccggtcatatccgcaaatattatccttagaaaattggctttgctacttagttggaagtagattttttta |
29220735 |
T |
 |
Q |
208 |
gatgtcacgattagcatcgtt |
228 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
29220736 |
gatgtcacgattagcatcgtt |
29220756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 192 times since January 2019
Visitors: 6125