View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_14 (Length: 363)
Name: NF0848_low_14
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 2653763 - 2653421
Alignment:
| Q |
12 |
ataggcggtatttaaacaaagattatgtatattgcttgtgcatatat--ctatatctcaatgttgcttcaaattgcatcttctcaaatccttacttgatg |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653763 |
ataggcggtatttaaacaaagattctgtatattgcttgtgcatatatatctatatctcaatgttgcttcaaattgcatcttctcaaatccttacttgatg |
2653664 |
T |
|
| Q |
110 |
ttttagatttaggattttaattatgtaagcagtaaacatttataactcaattggaatagctagattgatgttatttctattttatcaatttattttttgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653663 |
ttttagatttaggattttaattatgtaagcagtaaacatttataactcaattggaatagctagattgatgttatttctattttatcaatttattttttgt |
2653564 |
T |
|
| Q |
210 |
ggatatgtaatcaatgattacaacagactaagtaacttcaatttgtgactttaaattttctgttaaatgaaaattaattcatttcaaattgcaatataac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653563 |
ggatatgtaatcaatgattacaacagactaagtaacttcaatttgtgactttaaattttctgttaaatgaaaattaattcatttcaaattgcaatataac |
2653464 |
T |
|
| Q |
310 |
ttttgtttgctactcccttcctatgttcttctctttccttcat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653463 |
ttttgtttgctactcccttcctatgttcttctctttccttcat |
2653421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1008 times since January 2019
Visitors: 6135