View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_16 (Length: 328)
Name: NF0848_low_16
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0848_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 81 - 266
Target Start/End: Original strand, 18979365 - 18979550
Alignment:
Q |
81 |
ttaccttctaccgtaggactggtagatgggagtcacatatatggtatgtcgtattagggtcgtctctaagatttttggtactttaaacgaactatcaaaa |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
T |
18979365 |
ttaccttctaccgtaggactggtagatgggagtcacatatatggtatgtcgtattagggtcgtttctaagatttttggtactttaaacgaactaagaaaa |
18979464 |
T |
 |
Q |
181 |
tgatgccttgttaattatacgaatattatttttcttacattttttgtttcaaaattattaccactaacctggtatatgattatatt |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
18979465 |
tgatgccttgttaattatacgaatattatttttcttacattttttgtttcaaaatcattaccactaacctggtatatgattatatt |
18979550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 15133265 - 15133315
Alignment:
Q |
178 |
aaatgatgccttgttaattatacgaatattatttttcttacattttttgtt |
228 |
Q |
|
|
|||| ||||||| |||||||| | |||||| |||||||||||||||||||| |
|
|
T |
15133265 |
aaattatgcctttttaattattcaaatattttttttcttacattttttgtt |
15133315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1020 times since January 2019
Visitors: 6135