View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_18 (Length: 316)
Name: NF0848_low_18
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 14965307 - 14965420
Alignment:
| Q |
1 |
catttgaaactacttagagaaaatgacgtgatgaacaatctatcatgttgacgattgtgtaattctgagattagctagccatttgaatcaaatttcttca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14965307 |
catttgaaactacttagagaaaacgacgtgatgaacaatctatcatgttgacgattgtgtaattctgagattagctagtcatttgaatcaaatttcttca |
14965406 |
T |
|
| Q |
101 |
ttaattagctcgtg |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14965407 |
ttaattagctcgtg |
14965420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1731 times since January 2019
Visitors: 6149