View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_23 (Length: 260)
Name: NF0848_low_23
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 59 - 250
Target Start/End: Original strand, 56313834 - 56314025
Alignment:
| Q |
59 |
cagtgagctgttccaatactgctaccagtgctgcaatgatgatggatgatctcaataggcttgtaagttatcaacaacagcaatattgttacaatgttca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313834 |
cagtgagctgttccaatactgctaccagtgctgcaatgatgatggatgatctcaataggcttgtaagttatcaacaacagcaatattgttacaatgttca |
56313933 |
T |
|
| Q |
159 |
aaacccacatctcaatcatccaaatccgaatcatttgtctacattgctgatgcaaccgatgttaccaaatcaatttccaactaccttctctg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56313934 |
aaacccacatctcaatcatccaaatccgaatcatttgtctacattgctgatgcaaccaatgttaccaaatcaatttccaactaccttctctg |
56314025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 56313784 - 56313821
Alignment:
| Q |
3 |
tggtggcggcgggggcgccattttccctgtctcagctt |
40 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56313784 |
tggtggcggcgggggcgtcattttccctgtctcagctt |
56313821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 230 times since January 2019
Visitors: 6127