View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_25 (Length: 255)
Name: NF0848_low_25
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 84 - 228
Target Start/End: Original strand, 26798314 - 26798458
Alignment:
| Q |
84 |
ctttactttagaagcatgtgatgaagaaggtaagctgcgtgattccatgtcaagagaatcgcgtttttgggttgaaaaatgagaatgatcataaactcga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26798314 |
ctttactttagaagcatgtgatgaagaaggtaaactgcgtgattccatgtcaagagaatcacgtttttgggttgaaaaatgagaatgatcataaactcga |
26798413 |
T |
|
| Q |
184 |
ttgtcatgatgattatgctctgtgttgttatcatcctcctctttt |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26798414 |
ttgtcatgatgattatgctccgtgttgttatcttcctcctctttt |
26798458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 260 times since January 2019
Visitors: 6127