View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_27 (Length: 251)
Name: NF0848_low_27
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_27 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 24653835 - 24653614
Alignment:
| Q |
30 |
aagagaaatttgacaaatgatctcatgagcgtactttggttgtgaagcaagaaactaggggtaaaattcttatagtaagattgtatgtagatgatttgat |
129 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24653835 |
aagaaaaatttgacaaatggcctcatgagcgtactttggttgtgaagcaagaaactaggggtaaaattcttataataagattgtatgtagatgatttgat |
24653736 |
T |
|
| Q |
130 |
ctatacatggaatgatgaatagacatttgaatgttttaaaaattctatgaagtgcaagtttgcattgactgatttaaaaaagagttatcagatatctcaa |
229 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24653735 |
ctatacatggaatgataagtagacatttgaatgttttaaaaattctatgaagtgcaagtttgcattgactgatttagaaaagagttatcagatatctcaa |
24653636 |
T |
|
| Q |
230 |
aggtacatattcattctgaaaa |
251 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
24653635 |
aggtacatatttattctgaaaa |
24653614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 729 times since January 2019
Visitors: 6131