View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_28 (Length: 237)
Name: NF0848_low_28
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 42911019 - 42910794
Alignment:
| Q |
1 |
ttttgagtataatattttattgtatattactcaagatgggtgaatgtttgatcataaatttgctcctattactcccttacatgtaaggtttaatgctata |
100 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||| || ||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42911019 |
ttttgagtataataatttattgaatatgacttaaaatgggtgaatgtttgatcaaaaatttgatcctaagactcccttacatgtaaggtttaatgctata |
42910920 |
T |
 |
| Q |
101 |
tttagattattttgtttgtgaaattgtgttgttaatgatgaattgtaggtgactagtggaaaattgttgaagacttggacagctcattataaatctatag |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42910919 |
tttggattattttgtttgtgaaattgtgttgtttatgatgaattgtaggtgactagtggaaaattgttgaagacttggacagctcattataaatctgtag |
42910820 |
T |
 |
| Q |
201 |
accacataatattttctaatgatgat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42910819 |
accacataatattttctaatgatgat |
42910794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University