View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0848_low_29 (Length: 234)
Name: NF0848_low_29
Description: NF0848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0848_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 7948474 - 7948320
Alignment:
| Q |
1 |
gagttgatggatcagtagcagctgataagacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagataatcctgctttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948474 |
gagttgatggatcagtagcagctgataaaacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagataatcctgctttctc |
7948375 |
T |
|
| Q |
101 |
ggctgccgataataaacctgctttctctgccttggttaacagtctctgctgctcc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
7948374 |
ggctgccgataataaacctgctttctctgccttggttaacagtctcagttgctcc |
7948320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 720 times since January 2019
Visitors: 6130