View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_high_18 (Length: 304)
Name: NF0849_high_18
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 84 - 294
Target Start/End: Complemental strand, 40180258 - 40180048
Alignment:
| Q |
84 |
gctttggatttgttgactgttattgatttccctcaggaggtggagcaccaggaagaggggactaaactattgcactgtcggcaggttattacaggcttgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
40180258 |
gctttggatttgttgactgttattgatatccataaggaggtggagcacaaggaagaggggactaaactatcgcactgtcggaaggttattacagccttgt |
40180159 |
T |
|
| Q |
184 |
gtcggtttaaagattttgatgcagacaagcagttgatctttaaaatgattgcagacggtccgctaccgcgtccttcaaaatacgttttcaatgtgattat |
283 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
40180158 |
gtcagtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagacggtccgctacagcgtccttcaaaagaagttttcaatgtgattat |
40180059 |
T |
|
| Q |
284 |
taaggcctatg |
294 |
Q |
| |
|
|||| |||||| |
|
|
| T |
40180058 |
taagacctatg |
40180048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 179 - 250
Target Start/End: Complemental strand, 38604671 - 38604600
Alignment:
| Q |
179 |
cttgtgtcggtttaaagattttgatgcagacaagcagttgatctttaaaatgattgcagacggtccgctacc |
250 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |||||| ||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
38604671 |
cttgtgtcggtttgaagatttcgatgcagccaagcaattgatctttaaaatgatagaagatggtccgctacc |
38604600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 6 - 85
Target Start/End: Complemental strand, 43428900 - 43428821
Alignment:
| Q |
6 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgacaaattgtaggtgtctagttatctagc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43428900 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgagaaattgtaggtgtctagttatctagc |
43428821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 239
Target Start/End: Original strand, 44460734 - 44460794
Alignment:
| Q |
179 |
cttgtgtcggtttaaagattttgatgcagacaagcagttgatctttaaaatgattgcagac |
239 |
Q |
| |
|
||||||| ||||||||||||| || ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44460734 |
cttgtgtgggtttaaagatttcgaaacagccaagcagttgatccttaaaatgattgcagac |
44460794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 239
Target Start/End: Original strand, 44468267 - 44468327
Alignment:
| Q |
179 |
cttgtgtcggtttaaagattttgatgcagacaagcagttgatctttaaaatgattgcagac |
239 |
Q |
| |
|
||||||| ||||||||||||| || ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44468267 |
cttgtgtgggtttaaagatttcgaaacagccaagcagttgatccttaaaatgattgcagac |
44468327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 239
Target Start/End: Complemental strand, 34501950 - 34501890
Alignment:
| Q |
179 |
cttgtgtcggtttaaagattttgatgcagacaagcagttgatctttaaaatgattgcagac |
239 |
Q |
| |
|
||||||| |||||||| |||| || |||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
34501950 |
cttgtgtgggtttaaaaatttagaagcagccaagaagttgatccttaaaatgattgcagac |
34501890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3561 times since January 2019
Visitors: 6174