View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_high_6 (Length: 451)
Name: NF0849_high_6
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 86 - 440
Target Start/End: Complemental strand, 35210674 - 35210316
Alignment:
| Q |
86 |
caacaattctaatatcgggtcatacatatgattatgtaacctgaacgaaatagaaattgaatttgtgaagcaccttcatagccatttggatagcaattat |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35210674 |
caacaattctaatatcgggtcataaatatgattatgtaacctgaacgaaatagaaattgaatttgtgaagcaccttcatagccatttggatagcaatgat |
35210575 |
T |
|
| Q |
186 |
acattga---aaaactgaaaaattcttactccaagacatccttcttcttttgaaagatgcatcatgtctcaactgaac-tagttgatctttctatgcacc |
281 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35210574 |
acattgatcaaaaactgaaaaattcttactccaagacatccttcttcttttgaaagatgcatcatgtctcaactgaacctagttgatctttctatgcacc |
35210475 |
T |
|
| Q |
282 |
agaccaccttaacaaataaaccttctatgaatttaacaaaattcatttatcaacccttcatagcctcttgccaaccataaatcactagttggacttttgt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210474 |
agaccaccttaacaaataaaccttctatgaatttaacaaaattcatttatcaccccttcatagcctcttgccaaccataaatcactagttggacttttgt |
35210375 |
T |
|
| Q |
382 |
taacgatgactatcatggacgttcgagagaaaatacatatacacatccccttcattcat |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210374 |
taacaatgactatcatggacgttcgagagaaaatacatatacacatccccttcattcat |
35210316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 35210712 - 35210664
Alignment:
| Q |
30 |
accgcatcacaacaagggccaatatatatgcatatgaccaacaattcta |
78 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35210712 |
accgcatcacaacaagggccaatatatacgcatatgaccaacaattcta |
35210664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2411 times since January 2019
Visitors: 6162