View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_11 (Length: 400)
Name: NF0849_low_11
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0849_low_11 |
 |  |
|
[»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 317
Target Start/End: Complemental strand, 122965 - 122680
Alignment:
Q |
30 |
taaatatgttactaagacaatcttttaannnnnnnnnagaaggatcaagctctccctattcagaatgttggtacaggcgaggtaaattatatattttgct |
129 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
122965 |
taaatatgttactaagacaatcttttaatttttttt-agaaggatcaagctctccctattcagaatgttggtacaggcgaggtaaattatatattttgct |
122867 |
T |
 |
Q |
130 |
tttacatcatataaaatgtattcttatgtatttaatatttgttaacacaacatttttggaatttgaattttgtcaggtaggtttgtcccaaatgccagat |
229 |
Q |
|
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
122866 |
tt-acatcatataaaatgtattcttacatatttaatatttgttaacacaacatttttggaatttgaattttgtcaggtaggttcgtcccaaatgccagat |
122768 |
T |
 |
Q |
230 |
tataccactctttctcagctggacatcttatcggtcatcccaactgtaagtttatcaaatgtctttgttttactatatccgtcatatt |
317 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
122767 |
tataccactctttctcagctggacatcttatcggtcatcccaactgtaagtttatcaaatgtctttgttttactatatcagtcatatt |
122680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University