View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_19 (Length: 332)
Name: NF0849_low_19
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 111 - 319
Target Start/End: Complemental strand, 31645168 - 31644960
Alignment:
| Q |
111 |
ccacctgttcaccatatagcaaggttctgtataatgtaattattctcnnnnnnnnnnnnnnnnnaggaaataaatgtaaatattcttagttgcattgtgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645168 |
ccacctgttcaccatatagcaaggttctgtataatgtaattattctctttttttatttttttttaggaaataaatgtaaatattcttagttgcattgtgt |
31645069 |
T |
 |
| Q |
211 |
gtatccaagtctcattcttggctctcaaaaagtagctatcaggagtaataaatacacacatagccatattttgaatcaaacaaaaacaatagaatatcgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645068 |
gtatccaagtctcattcttggctctcaaaaagtagctatcaggagtaataaatacacacatagccatattttgaatcaaacaaaaacaatagaatatcgt |
31644969 |
T |
 |
| Q |
311 |
atctctgct |
319 |
Q |
| |
|
|||| |||| |
|
|
| T |
31644968 |
atctttgct |
31644960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University