View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_24 (Length: 323)
Name: NF0849_low_24
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 96 - 239
Target Start/End: Complemental strand, 40635747 - 40635604
Alignment:
| Q |
96 |
aagaagagtcgtggttgagattttatggatgcgttgaggtctttcaatgcttcatgtagatgatcagagagtatttctggtgagcaatgacgccgacttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40635747 |
aagaagagtcgtggttgagattttattgctgcgttgaggtctttcaatgcttcatgtagatgatcagagagtatttctggtgagcaatgacgccgacttc |
40635648 |
T |
 |
| Q |
196 |
ttatgctgttggctagttctattagtgcttttgatacctatgct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40635647 |
ttatgctgttggctagttctattagtgcttttgatacctctgct |
40635604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 96 - 239
Target Start/End: Complemental strand, 40647710 - 40647567
Alignment:
| Q |
96 |
aagaagagtcgtggttgagattttatggatgcgttgaggtctttcaatgcttcatgtagatgatcagagagtatttctggtgagcaatgacgccgacttc |
195 |
Q |
| |
|
|||||||||||||| || |||||||||| | ||||||||||| |||||||||| | |||| ||| ||||| ||||||||||||||||| |||| |||| |
|
|
| T |
40647710 |
aagaagagtcgtggctgtgattttatggcagtgttgaggtcttgcaatgcttcacgaagattatcggagagaatttctggtgagcaatggcgcctacttt |
40647611 |
T |
 |
| Q |
196 |
ttatgctgttggctagttctattagtgcttttgatacctatgct |
239 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |||| |
|
|
| T |
40647610 |
ttatgctgttggcaagttctattagtacttttgatacctctgct |
40647567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 96 - 193
Target Start/End: Complemental strand, 16861859 - 16861762
Alignment:
| Q |
96 |
aagaagagtcgtggttgagattttatggatgcgttgaggtctttcaatgcttcatgtagatgatcagagagtatttctggtgagcaatgacgccgact |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||| | | ||| ||||||| ||| ||||| ||||||||||| |||||||||||||||||||| || ||||| |
|
|
| T |
16861859 |
aagaagagtcgtggctgagattttatgggagtatcgagatctttcagtgcatcatgaagatgatcagaaagtatttctggtgagcaatggcgtcgact |
16861762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 144 - 239
Target Start/End: Original strand, 4780446 - 4780541
Alignment:
| Q |
144 |
gcttcatgtagatgatcagagagtatttctggtgagcaatgacgccgacttcttatgctgttggctagttctattagtgcttttgatacctatgct |
239 |
Q |
| |
|
|||||||| |||||||| ||||||||||| || |||||||| || | ||||||||||||||| |||||||| ||| |||||||||||| |||| |
|
|
| T |
4780446 |
gcttcatgaagatgatcggagagtatttcgggagagcaatgtcgacagtttcttatgctgttggaaagttctatcagtacttttgatacctctgct |
4780541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University