View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_25 (Length: 316)
Name: NF0849_low_25
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0849_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 116 - 303
Target Start/End: Original strand, 12194017 - 12194204
Alignment:
Q |
116 |
tcaagatacagatttttctcggatgcaattgagagataccagaaagagctaaccaaattactaaaatgatacacaaatggcctaagttactaaaattatt |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
12194017 |
tcaagatacagatttttctcggatgcaattgagagataccagaaagagctaaccaaattactaaaatgatacacaaatggcctaagttacgaaaattatt |
12194116 |
T |
 |
Q |
216 |
acaccatagttgtatctatttcgaatgccataaacatgtaataatgctctaacggaaaattatatctcttaggtaactatttatcttc |
303 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
12194117 |
acaccatagttgtatctatttcaaatgccataaacatgtaataatgctctaacggaaaattatatctcttaggtaactgtttatcttc |
12194204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 12193930 - 12193986
Alignment:
Q |
29 |
actagactcagcaaagaaaggaggcaatagaaacttgtttttaatgtactttggatg |
85 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12193930 |
actagactcagcaaagaaaggaggcaatagaaacttgtttttaatgtactttggatg |
12193986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University