View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_33 (Length: 299)
Name: NF0849_low_33
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 40743753 - 40744016
Alignment:
| Q |
7 |
tttgtcttcaactatttggagcttctcacgatctaatctagacttgatggtatttttcttcatccctatgcttacttcccacacatttacaaacccaact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40743753 |
tttgtcttcaactatttggagcttctcacgatctaatctagacttgatggtatttttcttcatccctatgcttacttcccacacatttacaaacccaact |
40743852 |
T |
|
| Q |
107 |
actttatgctcacaaataaataattatatgtttttaatgtacaaaagttctgtctcaaattataacttgttttgcnnnnnnntaataatcacatattata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40743853 |
actttatgctcacaaataaataattatatgtttttaatgtacaaaagttctgtctcaaattataacttgttttgcaaaaaaataataatcacatattata |
40743952 |
T |
|
| Q |
207 |
aattattcacaatatcaatcaaacaatagtgttatttttctattatagacctaaatatttaata |
270 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40743953 |
aattatttacaatatcaatcaaacaatagtgttatttttctattatagacctaaatatttaata |
40744016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 19293108 - 19293148
Alignment:
| Q |
212 |
ttcacaatatcaatcaaacaatagtgttatttttctattat |
252 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
19293108 |
ttcacaatatcaatgaaacattaatgttatttttctattat |
19293148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 541 times since January 2019
Visitors: 6130