View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0849_low_35 (Length: 285)

Name: NF0849_low_35
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0849_low_35
NF0849_low_35
[»] chr7 (1 HSPs)
chr7 (49-138)||(28547127-28547216)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 49 - 138
Target Start/End: Original strand, 28547127 - 28547216
Alignment:
49 aatggatgtttgatttgataaaaacttacttttattaacaaaatttccaattcattttaatctactttttaatttcaagcatttgtactg 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28547127 aatggatgtttgatttgataaaaacttacttttattaacaaaatttccaattcattttaatctactttttaatttcaagcatttgtactg 28547216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University