View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_35 (Length: 285)
Name: NF0849_low_35
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 49 - 138
Target Start/End: Original strand, 28547127 - 28547216
Alignment:
| Q |
49 |
aatggatgtttgatttgataaaaacttacttttattaacaaaatttccaattcattttaatctactttttaatttcaagcatttgtactg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28547127 |
aatggatgtttgatttgataaaaacttacttttattaacaaaatttccaattcattttaatctactttttaatttcaagcatttgtactg |
28547216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2931 times since January 2019
Visitors: 6168