View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_37 (Length: 257)
Name: NF0849_low_37
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0849_low_37 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 257
Target Start/End: Complemental strand, 2366723 - 2366496
Alignment:
Q |
30 |
atctggtcacaagagagaaaacattggtaagcattttaagagcctgtgtacttttctcatgtgaattgtactgtttttccattccatatatgtctggcat |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
T |
2366723 |
atctggtcacaagagagaaaacattggtaagcattttaagagcatgtgtacttttctcatgtgatttgtactgtttttccattccatatatgtcaggcat |
2366624 |
T |
 |
Q |
130 |
ggaatggacaaggttgcactcaagctttaacagatcaatcacatctgcttcttctggtacacaaacatgcactgttacttcattcccttcagaagaatct |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2366623 |
ggaatggacaaggttgcactcaagctttaacaaatcaatcacatctgcttcttttggtacacaaacatgcactgttacttcattcccttcagaagaatct |
2366524 |
T |
 |
Q |
230 |
ctcaagtcttgtccaggcatggaatatc |
257 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
2366523 |
ctcaagtcttgtccaggcatggaatatc |
2366496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University