View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_42 (Length: 252)
Name: NF0849_low_42
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 55 - 252
Target Start/End: Original strand, 43363418 - 43363616
Alignment:
| Q |
55 |
taaatgagccacattgtgcttaacttgaattgtaaacttgaaccaccaccttagggcaagtgattgtacgtgccataataaacaaaccacgtttatccat |
154 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43363418 |
taaatgagctacactgtgtttaacttgaattgtaagcttgaaccaccaccttagggcaagtgattgtacgtgccataataaacaaaccacgtttatccat |
43363517 |
T |
|
| Q |
155 |
ttaaagtgtagtagaaccatgttgctggaaaaaccttgtttcaacatgcaaatt-aataattaaaggaaataaccaagtagagcctttagctagcatat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43363518 |
ttaaagtgtagtagaaccatgttgctggaaaaaccttgtttcaacatgcaaattaaataattaaaggaaataaccaagtagagcctttagctagcatat |
43363616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2528 times since January 2019
Visitors: 6164