View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_43 (Length: 252)
Name: NF0849_low_43
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 10 - 111
Target Start/End: Original strand, 21656765 - 21656866
Alignment:
| Q |
10 |
attattctatcaacttatgtaattttcctatattatttactatatttcaatgtcatagttatagctaaatagacccatgcatcgcacgggtgtagttcta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
21656765 |
attattctatcaacttatgtaattttcctatattatttactatatttcaatgtcatagttatagctaaatagacccgtgcatcgcacgggtgttgttcta |
21656864 |
T |
|
| Q |
110 |
gt |
111 |
Q |
| |
|
|| |
|
|
| T |
21656865 |
gt |
21656866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2808 times since January 2019
Visitors: 6167