View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_44 (Length: 251)
Name: NF0849_low_44
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0849_low_44 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 121 - 251
Target Start/End: Complemental strand, 41876983 - 41876853
Alignment:
| Q |
121 |
tttggtaccgtttgaattacaataaaatgttatttataaattcaaataaatggtatgtaaaatactcaagttgtataaattttgaattaattcaaatata |
220 |
Q |
| |
|
|||||| |||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41876983 |
tttggtgccgtttaaattacaataaaatattatttgtaaattcaaataaatggtatgtaaaatactcaagttgtataaatttcgaattaattcaaatata |
41876884 |
T |
|
| Q |
221 |
ttttatttcaaattagtaaatgctagtagca |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
41876883 |
ttttattttaaattagtaaatgctagtagca |
41876853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 41877029 - 41876991
Alignment:
| Q |
30 |
caaatttcttaaaataaattgagatgcagggatcaaacc |
68 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
41877029 |
caaatttcttaaaataaattgagatgtagggataaaacc |
41876991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2535 times since January 2019
Visitors: 6164